6nkmdmfjshid 6nkmdmfjshid

English

Answered

1. Is “When it is foggy, driving is very dangerous” a complex sentence?

Sagot :

Ebocaid Ebocaid

Answer:

I would say yes because a complex sentence is an independent clause with at least one dependent clause.

Answer Link

ID Other Questions

Neurosecretory Cells Make And Release The Hormones Of The Posterior Pituitary. The Cell Bodies Of These Neurosecretory Cells Receive Synapses From _______, And

The Length Of A Field In Yards Is A Function F(n) Of The Length N In Feet. Write A Function Rule For This Situation. A. F(n) = 1/3nB. F(n)= N/12 C. F(n) = 12n

Which Of The Following Is A Difference Between The Roman And Byzantine Empires? (4 Points) A The Byzantines Did Not Use Columns In Their Buildings. B The Byzant

Which Of The Following Would Provide The First Codon?mRNA: UUCAAUGCCUCAAGGUUAAAGCGGCGGUUCCCUGGCAUG

Luis Has A Square Pasture With A Surface Area Of 1800 M² And Is Not Fenced. In The Center Of The Pasture There Is A Tree From Which He Ties His Horse With A Rop

Find The Value Of X.

Which Excerpt From Winona Laduke’s A Case For Waawaatesi" Best Appeals To Readers’ Logic? Every Year Millions Of Birds Die Colliding With Needlessly Illuminated

Review The Five Impacts Of Technology Dependence Listed In "How Technology Lowers Emotional Intelligence In Kids." Which Two Were Most Evident In Peter And Wend

You Are Offered A Loan Package On A New Car At The Dealership. The Loan Is For 4 Years, At 4.75% APR, And The Monthly Payment Is $258. What Is The Actual Cost O

Consider A Firm That Is Expected To Pay The Following Dividends: (use A Excel Spreadsheet To Calculate The Values) Year 1 2 3 4 5 6 $1.20 $1.20 $1.50 $1.50 $1.7