Sundaecookie12id Sundaecookie12id

History

Answered

David went to the store and bought two apples and a pear.

What is the plural noun in the sentence?

David Went To The Store And Bought Two Apples And A Pear What Is The Plural Noun In The Sentence class=

Sagot :

Paladintylerid Paladintylerid

Answer:

apples

Explanation:

A noun is a person, place, or thing. Plural means that there are multiple/more than one. An apple is a thing, and in the sentence, there are multiple apples.

Answer Link

Osyisachickmunkid Osyisachickmunkid

Answer:apples

Explanation:

Answer Link

ID Other Questions

Find The Distance Between Points (a, B) And (-a, -b).

An Engineer Is Designing A Runway For An Airport. Of The Planes That Will use This Airport, The Lowest Acceleration Rate Is Likely To Be 4 M/s^2. The takeoff Sp

The Graph Of A Linear System Is Shown. What Is The Solution To This Linear System? Enter A Value In Each Box To Create An Ordered Pair.

What Is The Ability For A Substance To Flow

Here Is The Questions Sorry Lol

Why Was Balboa Forced To Return To Spain

Sister Chromatids Are Not Bivalent And Therefore Cannot Form Tetrads. The Synaptonemal Complex Is The Fusion Of The Sister Chromatids At The Start Of Meiosis I.

AUUUAACUGUUCUGUCUAGAG 1. Construct An Explanation Based Only On The Information Provided, Why Could The mRNA Section Be Translated Into Three Different Sets Of

What Were The 2 Ancient Civilizations That Benefited The Romans?

Which Of The Following Terms Is Defined As Small Bumps And Slashes Within A Fluid Power System? macrostructures microstructures friction reservoirs